miRBase entry: hsa-mir-877

Stem-loop hsa-mir-877


Accession
MI0005561
Symbol
HGNC: MIR877
Description
Homo sapiens hsa-mir-877 precursor miRNA mir-877
Gene
family?
RF00912; mir-877

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

hsa-mir-877 is a microRNA that has been implicated in various biological processes and diseases, including acting as an oncogene in gastric cancer [PMC7794682]. It is one of the most abundant miRNAs associated with high-density lipoprotein (HDL) in normal subjects, which suggests a potential role in lipid metabolism or cardiovascular health [PMC3074610]. Additionally, hsa-mir-877 has been identified as upregulated in nonresponder samples of both lung squamous cell carcinoma (LUSC) and head and neck squamous cell carcinoma (HNSC), suggesting a possible involvement in cancer progression or response to therapy [PMC7794682]. Interestingly, hsa-mir-877 is listed among both upregulated and downregulated miRNAs across various studies, indicating complex regulatory roles that may be context-dependent [PMC6921333]. However, it has not been confirmed as a potential endogenous control gene for expression studies due to its relatively uniform expression among candidate reference genes, as other genes were found to be more uniformly expressed [PMC3531299].

Literature search
31 open access papers mention hsa-mir-877
(62 sentences)

Sequence

10072 reads, 83 reads per million, 97 experiments
GUAGAGGAGAUGGCGCAGGGgacacgggcaaagacuuggggguuccugggacccucagacgugugUCCUCUUCUCCCUCCUCCCAG
...((((((..((.(.((((((((((.(.......((((((((((...)))))))))).).)))))))))).).))))))))....

Structure
-GUA      AU  C C          g caaagac          c 
    GAGGAG  GG G AGGGgacacg g       uuggggguuc  
    ||||||  || | |||||||||| |       |||||||||| u
    CUCCUC  CC C UCUCCUgugu c       gacucccagg  
GACC      --  U U          g ------a          g 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr6: 30584332-30584417 [+]

Disease association
hsa-mir-877 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-877-5p

Accession MIMAT0004949
Description Homo sapiens hsa-miR-877-5p mature miRNA
Sequence 1 - GUAGAGGAGAUGGCGCAGGG - 20
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-877-3p

Accession MIMAT0004950
Description Homo sapiens hsa-miR-877-3p mature miRNA
Sequence 66 - UCCUCUUCUCCCUCCUCCCAG - 86
Evidence experimental
cloned [1-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 17964270
    Mammalian mirtron genes
    "Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC"
    "Mol Cell (2007) 28:328-336