Stem-loop hsa-mir-760

Accession

MI0005567

Symbol

HGNC: MIR760

Description

Homo sapiens hsa-mir-760 precursor miRNA

Gene family

MIPF0000395; mir-760

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR760 is a microRNA that has been implicated in various types of cancer, such as ovarian, liver, and colorectal cancer (Liao et al. [PMC7462065]). In a study conducted by Liao et al., it was observed that alterations in MIR760 expression, both up and down, were associated with these forms of cancer (Liao et al. [PMC7462065]). Additionally, the study found that inhibiting MIR760 or mutating its binding site in the 5′ UTR of ATXN1 led to a significant increase in ATXN1 protein levels (Liao et al. [PMC7462065]). This suggests that MIR760 may play a role in regulating ATXN1 expression. The findings highlight the potential importance of MIR760 as a therapeutic target or biomarker for cancer treatment and diagnosis. Further research is needed to fully understand the mechanisms by which MIR760 influences cancer development and progression.

Literature search

20 open access papers mention hsa-mir-760
(159 sentences)

Sequence

6551 reads, 305 reads per million, 63 experiments

ggcgcgucgccccccucaguccaccagagcccggauaccucagaaauuCGGCUCUGGGUCUGUGGGGAgcgaaaugcaac
.(((..((((.((((.(((....((((((((.((((.........))))))))))))..))).)))).))))..)))...

Structure

--g   cg    c    u   ucca        c    acc 
   gcg  ucgc cccc cag    ccagagcc ggau   u
   |||  |||| |||| |||    |||||||| ||||   c
   cgu  agcg GGGG GUC    GGUCUCGG Cuua   a
caa   aa    A    U   --UG        -    aag 

Annotation confidence High

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr1: 93846832-93846911 [+]

Disease association

hsa-mir-760 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-760

• Accession: MIMAT0004957
• Description: Homo sapiens hsa-miR-760 mature miRNA
• Sequence: 49 - CGGCUCUGGGUCUGUGGGGA - 68
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298