miRBase entry: hsa-mir-760

Stem-loop hsa-mir-760


Accession
MI0005567
Symbol
HGNC: MIR760
Description
Homo sapiens hsa-mir-760 precursor miRNA mir-760
Gene
family?
RF00915; mir-760

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR760 is a microRNA that has been observed to have varying expression levels in different types of cancer, such as ovarian, liver, and colorectal cancers [PMC7462065]. The alteration in the expression of MIR760, whether it is overexpressed or underexpressed, has been implicated in the development of these cancers [PMC7462065]. Studies have shown that when MIR760 is suppressed or when its binding site is mutated, there is a notable increase in the levels of the ATXN1 protein [PMC7462065]. Since ATXN1 protein dysregulation is linked to neurodegenerative diseases, MIR760 may have a regulatory role in the expression of genes that are crucial in both oncogenesis and neurodegeneration [PMC7462065].

Literature search
20 open access papers mention hsa-mir-760
(159 sentences)

Sequence

6542 reads, 305 reads per million, 60 experiments
ggcgcgucgccccccucaguccaccagagcccggauaccucagaaauuCGGCUCUGGGUCUGUGGGGAgcgaaaugcaac
.(((..((((.((((.(((....((((((((.((((.........))))))))))))..))).)))).))))..)))...

Structure
--g   cg    c    u   ucca        c    acc 
   gcg  ucgc cccc cag    ccagagcc ggau   u
   |||  |||| |||| |||    |||||||| ||||   c
   cgu  agcg GGGG GUC    GGUCUCGG Cuua   a
caa   aa    A    U   --UG        -    aag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr1: 93846832-93846911 [+]

Disease association
hsa-mir-760 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-760

Accession MIMAT0004957
Description Homo sapiens hsa-miR-760 mature miRNA
Sequence 49 - CGGCUCUGGGUCUGUGGGGA - 68
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298