MIR301B is a microRNA, a small non-coding RNA molecule, which plays a role in the regulation of gene expression [PMC8109121]. Its expression, along with other microRNAs such as miR-454, miR301a, miR130a, and miR130b, was quantified using the 2-ΔΔCt method with normalization to U6 [PMC8109121]. The study of these microRNAs led to further investigation into the influence of BHLHE40/41 on the expression levels of MIR130B and MIR301B [PMC6659797]. This suggests that BHLHE40/41 may be a regulatory factor affecting MIR301B expression [PMC6659797].
 
                            ---g  g        C      ---G        A  gugc 
    cc cagguGCU UGACGA    GUUGCACU CU    u
    || |||||||| ||||||    |||||||| ||    c
    gg gucuaCGA ACUGUU    UAACGUGA ga    u
acca  -        A      AUAG        C  agag 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Accession | MIMAT0004958 | 
| Description | Homo sapiens hsa-miR-301b-3p mature miRNA | 
| Sequence | 45 - CAGUGCAAUGAUAUUGUCAAAGC - 67 | 
| Evidence | experimental cloned [2] | 
| Database links |       | 
| Predicted targets |     | 
| Accession | MIMAT0032026 | 
| Description | Homo sapiens hsa-miR-301b-5p mature miRNA | 
| Sequence | 10 - GCUCUGACGAGGUUGCACUACU - 31 | 
| Evidence | not_experimental | 
| Database links |       | 
| Predicted targets |     | 
| 
 |