Stem-loop hsa-mir-216b

Accession

MI0005569

Symbol

HGNC: MIR216B

Description

Homo sapiens hsa-mir-216b precursor miRNA

Gene family

MIPF0000054; mir-216

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR216B is a microRNA that has been studied in various types of cancer, including pancreatic ductal adenocarcinoma (PDAC), non-small cell lung cancer (NSCLC), colorectal cancer (CRC), hepatocellular carcinoma (HCC), cervical cancer, and colon cancer. In PDAC cells, MIR216B was incorporated into liposomes and showed improved cell penetration [PMC9683052]. In NSCLC cells, MIR216B was found to be sponged by lncPVT1, leading to inhibition of Beclin-1 expression and induction of cisplatin tolerance [PMC9373174]. MIR216B was downregulated in colorectal cancer compared to normal tissues and its low expression correlated with poor prognosis [PMC6504855]. In HCC cells, MIR216B inhibited autophagy by targeting MALAT1 and increased chemosensitivity [PMC6504855]. In NSCLC cells treated with paclitaxel, MIR216B levels were downregulated and it targeted BECN1 upregulation to increase autophagy [PMC9738256]. In cervical cancer, MIR216B targeted FOXM1 and inhibited cell proliferation [PMC7582726]. Additionally, in colon cancer, SNHG7 sponged MIR216B to increase GALNT1 expression and promote cell migration and invasion [PMC6912041]. SNHG7 also promoted liver metastasis of CRC by upregulating GALNT1 through sponging MIR216B [PMC9482270]. Furthermore, in murine tumor models of breast cancer (4T1 cells) and lung metastasis (6DT1 cells), ectopic expression of MIR216B resulted in tumor suppression but had minimal effect on primary tumor growth [PMC3912413]. The expression levels of MIR216B were quantified using the comparative cycle threshold method [PMC5732799].

Literature search

57 open access papers mention hsa-mir-216b
(186 sentences)

Sequence

478 reads, 39 reads per million, 34 experiments

gcagacuggaAAAUCUCUGCAGGCAAAUGUGAugucacugaggaaaucACACACUUACCCGUAGAGAUUCUAcagucugaca
.(((((((...(((((((((.((.((.((((((.((......)).))))))...)).)).)))))))))...)))))))...

Structure

--g       gaA         A  C  --A      g  ac 
   cagacug   AAUCUCUGC GG AA   UGUGAu uc  u
   |||||||   ||||||||| || ||   |||||| ||   
   gucugac   UUAGAGAUG CC UU   ACAcua ag  g
aca       AUC         C  A  CAC      a  ga 

Annotation confidence Not enough data

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr2: 56000714-56000795 [-]

Disease association

hsa-mir-216b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-216b-5p

• Accession: MIMAT0004959
• Description: Homo sapiens hsa-miR-216b-5p mature miRNA
• Sequence: 11 - AAAUCUCUGCAGGCAAAUGUGA - 32
• Evidence: experimental ; cloned [2], Illumina [3]

Mature hsa-miR-216b-3p

• Accession: MIMAT0026721
• Description: Homo sapiens hsa-miR-216b-3p mature miRNA
• Sequence: 49 - ACACACUUACCCGUAGAGAUUCUA - 72
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45