miRBase entry: hsa-mir-216b

Stem-loop hsa-mir-216b


Accession
MI0005569
Symbol
HGNC: MIR216B
Description
Homo sapiens hsa-mir-216b precursor miRNA mir-216
Gene
family?
RF00654; mir-216

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR216B, a microRNA, has been implicated in various cancer-related processes, including cell proliferation, migration, invasion, and chemosensitivity [PMC6504855]. It has been shown to be downregulated in colorectal cancer and its low expression is associated with poor patient prognosis [PMC6504855]. MIR216B is known to target oncogenic KRASG12D in pancreatic ductal adenocarcinoma cells and has been functionalized on the surface of liposomes to improve cell penetration [PMC9683052]. It also interacts with the long non-coding RNA MALAT1 in hepatocellular carcinoma (HCC) cells, where its levels inversely correlate with MALAT1 expression; both MIR216B mimics and MALAT1-siRNA can inhibit autophagy and increase apoptosis when chemoresistance is present [PMC6504855]. Additionally, MIR216B can be sponged by lncPVT1 to inhibit Beclin-1 expression and induce cisplatin tolerance by regulating apoptosis and autophagy in non-small cell lung cancer (NSCLC) cells [PMC9373174]. Furthermore, MIR216B modulates the PIK3CA/AKT/MTOR signaling pathway through its interaction with SNHG7 lncRNA which sponges MIR216B to promote colorectal cancer cell migration and invasion by increasing GALNT1 levels [PMC6912041], [PMC9482270]. In breast cancer models, overexpression of MIR216B resulted in a moderate tumor suppressive effect but significantly reduced pulmonary metastasis [PMC3912413].

Literature search
108 open access papers mention hsa-mir-216b
(538 sentences)

Sequence

841 reads, 9.0 reads per million, 59 experiments
gcagacuggaAAAUCUCUGCAGGCAAAUGUGAugucacugaggaaaucacACACUUACCCGUAGAGAUUCUAcagucugaca
.(((((((...(((((((((.((.((.((((((.((......)).))))))...)).)).)))))))))...)))))))...

Structure
--g       gaA         A  C  --A      g  ac 
   cagacug   AAUCUCUGC GG AA   UGUGAu uc  u
   |||||||   ||||||||| || ||   |||||| ||   
   gucugac   UUAGAGAUG CC UU   Acacua ag  g
aca       AUC         C  A  CAC      a  ga 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr2: 56000714-56000795 [-]

Disease association
hsa-mir-216b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-216b-5p

Accession MIMAT0004959
Description Homo sapiens hsa-miR-216b-5p mature miRNA
Sequence 11 - AAAUCUCUGCAGGCAAAUGUGA - 32
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-216b-3p

Accession MIMAT0026721
Description Homo sapiens hsa-miR-216b-3p mature miRNA
Sequence 51 - ACACUUACCCGUAGAGAUUCUA - 72
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45