Stem-loop sequence ghr-MIR162a

AccessionMI0005644 (change log)
DescriptionGossypium hirsutum miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

12 open access papers mention ghr-MIR162a
(24 sentences)

Stem-loop
   -----------uuuuuagcguu     a   a a     g    c    c       uc   c  aga    -      g 
5'                       ggggu aag c cugga gcag gguu aucgauc  uuc ug   auuu uguugu a
                         ||||| ||| | ||||| |||| |||| |||||||  ||| ||   |||| ||||||  
3'                       ucuca uuc g gaccu cguc ccaa uagcuag  aag ac   uaaa acaaua g
   auugauuguauuuugaaguacc     a   c c     a    u    a       cu   u  --a    c      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR162a

Accession MIMAT0005812
Sequence

94 - 

ucgauaaaccucugcauccag

 - 114

Get sequence
Evidence by similarity; MI0002209

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).