Stem-loop sequence ppt-MIR319e

AccessionMI0005665 (change log)
DescriptionPhyscomitrella patens miR319e stem-loop
Gene family MIPF0000010; MIR159
Literature search

3 open access papers mention ppt-MIR319e
(15 sentences)

Stem-loop 
   cuagccg            c        u  ug     -ug     -      u   g   au   a  uuc   c      u  uu 
5'        ugggagcuccuu cgguucaa ag  gcuga   ugagg uugcac gcu ccg  uca ac   cgg uucccu uc  a
          |||||||||||| |||||||| ||  |||||   ||||| |||||| ||| |||  ||| ||   ||| |||||| ||  a
3'        acccucgaggga gucagguu uc  cgauu   acuuc ggcgug cga ggc  agu ug   gcc aaggga ag  c
   -uucuga            a        c  cg     uca     u      u   g   gu   c  uaa   u      c  ca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr15: 7525796-7525969 [-]
intergenic
Database links

Mature sequence ppt-miR319e

Accession MIMAT0004354
Sequence

147 -  

cuuggacugaagggagcuccc

 - 167

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).