![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppt-MIR414 |
|||||
Accession | MI0005669 (change log) | ||||
Description | Physcomitrella patens miR414 stem-loop | ||||
Gene family | MIPF0000375; MIR414 | ||||
Literature search |
1 open access papers mention ppt-MIR414 | ||||
Stem-loop |
----------------------------a uuc -acaauua a caaugcuagaauguggggcucaccagauuuuccaacugcauuggcua 5' gacg aaga gaga gac g |||| |||| |||| ||| 3' cugc uucu uucu cug c gacuacgacuccugcuccuacuacuccua --- acuacugc a cuacuacuucuacuguuucuauaccaaugacgguuucgcgaucgucu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppt-miR414 |
|
Accession | MIMAT0004357 |
Sequence |
146 - ucauccucaucauccucgucc - 166 |
Evidence | experimental; Northern [1] |
References |
|
1 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
2 |
PMID:16669754
"MicroRNAS and their regulatory roles in plants"
Annu Rev Plant Biol. 57:19-53(2006).
|