Stem-loop ppt-MIR414

Accession

MI0005669

Description

Physcomitrella patens ppt-MIR414 precursor miRNA

Literature search

1 open access papers mention ppt-MIR414
(2 sentences)

Sequence

agacguucaagaacaauuagagaagaccaaugcuagaauguggggcucaccagauuuuccaacugcauuggcuagcucugcuagcgcuuuggcaguaaccauaucuuugucaucuucaucaucgucaucuucgucaucaucuucgUCAUCCUCAUCAUCCUCGUCCucagcaucag
.((((...((((.......((((.(((((((((.(((((.(((......))).)))))......))))))((((((...))))))....((((((...........))))))...........))).))))........)))))))).............................

Structure

----------------------------a    uuc    -acaauua    a   -----------------------------------------------------      -----u     g   gg 
                             gacg   aaga        gaga gac                                                     caaugc      agaau ugg  c
                             ||||   ||||        |||| |||                                                     ||||||      ||||| |||   
                             CUgc   uucu        uucu cug                                                     guuacg      uuuua acc  u
gacuacgacuCCUGCUCCUACUACUCCUA    ---    acuacugc    a   cuacuacuucuacuguuucuauaccaaugacgguuucgcgaucgucucgaucg      ucaacc     g   ac 

Annotation confidence Not enough data

Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context

Chr11: 12877706-12877881 [+]

Mature ppt-miR414

• Accession: MIMAT0004357
• Description: Physcomitrella patens ppt-miR414 mature miRNA
• Sequence: 146 - UCAUCCUCAUCAUCCUCGUCC - 166
• Evidence: experimental ; Northern [1]

References

1. PubMed ID: 16669754
   MicroRNAS and their regulatory roles in plants
   "Jones-Rhoades MW, Bartel DP, Bartel B"
   "Annu Rev Plant Biol (2006) 57:19-53


2. PubMed ID: 17359535
   Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
   Fattash I, Voss B, Reski R, Hess WR, Frank W
   BMC Plant Biol (2007) 7:13