![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppt-MIR419 |
|||||
Accession | MI0005670 (change log) | ||||
Description | Physcomitrella patens miR419 stem-loop | ||||
Literature search |
1 open access papers mention ppt-MIR419 | ||||
Stem-loop |
- -u -uua a uaaccgua ca gu 5' ggu gccugug guuau guuc aguc c c ||| ||||||| ||||| |||| |||| | 3' cua cggauau cagua uaag ucgg g g u uc guag g -----uag ag ag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppt-miR419 |
|
Accession | MIMAT0004358 |
Sequence |
52 - ugaugaaugaugacgauguau - 72 |
Evidence | experimental; Northern [1] |
References |
|
1 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
2 |
PMID:16669754
"MicroRNAS and their regulatory roles in plants"
Annu Rev Plant Biol. 57:19-53(2006).
|