Stem-loop sequence ppt-MIR419

Accession

MI0005670 (change log)

Description

Physcomitrella patens miR419 stem-loop

Literature search

1 open access papers mention ppt-MIR419
(1 sentences)

Stem-loop

   -   -u       -uua     a    uaaccgua    ca gu 
5'  ggu  gccugug    guuau guuc        aguc  c  c
    |||  |||||||    ||||| ||||        ||||  |   
3'  cua  cggauau    cagua uaag        ucgg  g  g
   u   uc       guag     g    -----uag    ag ag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context

• Coordinates (v3.0): Chr06: 8028394-8028475 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0005670

Mature sequence ppt-miR419

• Accession: MIMAT0004358
• Sequence: 52 - ugaugaaugaugacgauguau - 72
• Evidence: experimental; Northern [1]

References

1. PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2. PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).