Stem-loop sequence dme-mir-962

AccessionMI0005817 (change log)
DescriptionDrosophila melanogaster miR-962 stem-loop
Gene family MIPF0001011; mir-962
Literature search

1 open access papers mention dme-mir-962
(5 sentences)

Stem-loop
   gau      cu    cuau       a        ugcu    aca 
5'    ggggca  cagg    aagguag gaaauuga    gucu   c
      ||||||  ||||    ||||||| ||||||||    ||||   u
3'    ccccgu  guuu    uuccauu cuuugacu    caga   a
   uac      uu    aacu       a        ---u    cuu 
Get sequence
Deep sequencing
1269 reads, 50 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5641298-5641389 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 4
Clustered miRNAs
< 10kb from dme-mir-962
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-962-5p

Accession MIMAT0005476
Previous IDsdme-miR-962
Sequence

18 - 

auaagguagagaaauugaugcuguc

 - 42

Get sequence
Deep sequencing1090 reads, 44 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-962-3p

Accession MIMAT0020857
Sequence

55 - 

acuucaguuucauuaccuuuca

 - 76

Get sequence
Deep sequencing179 reads, 17 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).