Stem-loop sequence dme-mir-1013

AccessionMI0005874 (change log)
DescriptionDrosophila melanogaster miR-1013 stem-loop
Gene family MIPF0000985; mir-1013
Literature search

1 open access papers mention dme-mir-1013
(1 sentences)

Stem-loop
   --        c   c    -a      a  a 
5'   gugaguuu gua acuu  auuaau gg u
     |||||||| ||| ||||  |||||| || c
3'   cgcucaag cgu ugaa  uaauug cc g
   ga        c   a    aa      -  g 
Get sequence
Deep sequencing
2394 reads, 2.04 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 30791636-30791696 [-]
sense
FBtr0085720 ; wts-RA; intron 6
Database links

Mature sequence dme-miR-1013-3p

Accession MIMAT0005026
Previous IDsdme-miR-1013
Sequence

39 - 

auaaaaguaugccgaacucg

 - 58

Get sequence
Deep sequencing2363 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).