Stem-loop sequence hiv1-mir-N367

AccessionMI0006104 (change log)
DescriptionHuman immunodeficiency virus 1 miR-N367 stem-loop
Stem-loop 
   --     -a   u   a  -    -  c   -    c 
5'   uuggc  gaa uac ca ccag gg cag ggau a
     |||||  ||| ||| || |||| || ||| |||| g
3'   gaucg  cuu gug gu gguu cc guc ccua a
   au     aa   c   -  a    u  a   a    u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Extensive studies in two labs have failed to confirm the existence of any viral miRNAs in HIV [3,4]. This sequence should be considered at risk of deletion from future releases of miRBase.

Database links

Mature sequence hiv1-miR-N367

Accession MIMAT0004478
Sequence

40 -  

acugaccuuuggauggugcuucaa

 - 63

Get sequence
Evidence experimental; cloned [2], Northern [2]

References

1
PMID:15601474 "HIV-1 nef suppression by virally encoded microRNA" Omoto S, Ito M, Tsutsumi Y, Ichikawa Y, Okuyama H, Brisibe EA, Saksena NK, Fujii YR Retrovirology. 1:44(2004).
2
PMID:15722536 "Regulation of human immunodeficiency virus 1 transcription by nef microRNA" Omoto S, Fujii YR J Gen Virol. 86:751-755(2005).
3
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
4
PMID:17855543 "Analysis of the interaction of primate retroviruses with the human RNA interference machinery" Lin J, Cullen BR J Virol. 81:12218-12226(2007).