Stem-loop sequence hiv1-mir-H1

AccessionMI0006106 (change log)
DescriptionHuman immunodeficiency virus 1 miR-H1 stem-loop
Stem-loop
   ------u  -         -   c  --g      -      a u 
5'        cc agggaggcg ugc ug   gcggga cugggg g g
          || ||||||||| ||| ||   |||||| |||||| | g
3'        gg uuuuuucgc acg au   cguccu gacucc c c
   auugcgu  c         g   a  aua      a      - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hiv1-miR-H1

Accession MIMAT0004480
Sequence

2 - 

ccagggaggcgugccugggc

 - 21

Get sequence
Evidence experimental; Northern [1]

References

1
"Evidence and nature of a novel miRNA encoded by HIV-1" Kaul D, Khanna A and Suman Proc Indian Natn Sci Acad. 72:91-95(2006).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
PMID:19082544 "HIV-1 genome-encoded hiv1-mir-H1 impairs cellular responses to infection" Kaul D, Ahlawat A, Gupta SD Mol Cell Biochem. 323:143-148(2009).
4
5
PMID:20546828 "HIV-miR-H1 evolvability during HIV pathogenesis" Lamers SL, Fogel GB, McGrath MS Biosystems. 101:88-96(2010).