Stem-loop sequence hiv1-mir-H1

Accession

MI0006106 (change log)

Description

Human immunodeficiency virus 1 miR-H1 stem-loop

Stem-loop

   ------u  -         -   c  --g      -      a u 
5'        cc agggaggcg ugc ug   gcggga cugggg g g
          || ||||||||| ||| ||   |||||| |||||| | g
3'        gg uuuuuucgc acg au   cguccu gacucc c c
   auugcgu  c         g   a  aua      a      - g 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Database links

• miRBase Tracker:MI0006106

Mature sequence hiv1-miR-H1

• Accession: MIMAT0004480
• Sequence: 2 - ccagggaggcgugccugggc - 21
• Evidence: experimental; Northern [1]

References

1. "Evidence and nature of a novel miRNA encoded by HIV-1" Kaul D, Khanna A and Suman Proc Indian Natn Sci Acad. 72:91-95(2006).
2. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3. PMID:19082544 "HIV-1 genome-encoded hiv1-mir-H1 impairs cellular responses to infection" Kaul D, Ahlawat A, Gupta SD Mol Cell Biochem. 323:143-148(2009).
4. PMID:17855543 "Analysis of the interaction of primate retroviruses with the human RNA interference machinery" Lin J, Cullen BR J Virol. 81:12218-12226(2007).
5. PMID:20546828 "HIV-miR-H1 evolvability during HIV pathogenesis" Lamers SL, Fogel GB, McGrath MS Biosystems. 101:88-96(2010).