Stem-loop sequence tae-MIR1117

AccessionMI0006179 (change log)
DescriptionTriticum aestivum miR1117 stem-loop
Literature search

7 open access papers mention tae-MIR1117
(18 sentences)

Stem-loop
   -- u     aauggga     -   ac     c                    a  ucu 
5'   g uugaa       ccuuu agu  cgguu guggcacgaaccgggacuaa gg   c
     | |||||       ||||| |||  ||||| |||||||||||||||||||| ||    
3'   c gauuu       ggaaa uca  gccaa caccgugcuuggccuugauu cc   a
   cg u     cgaggag     a   gc     a                    a  cca 
Get sequence
Deep sequencing
46349 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR501 in [1]. miR1117 is unrelated to mammalian miR-501;

Genome context
Coordinates Overlapping transcripts
3B: 744964271-744964387 [+]
intergenic
Database links

Mature sequence tae-miR1117

Accession MIMAT0005352
Sequence

19 - 

uaguaccgguucguggcacgaacc

 - 42

Get sequence
Deep sequencing23696 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).