Stem-loop sequence tae-MIR1123

AccessionMI0006185 (change log)
DescriptionTriticum aestivum miR1123 stem-loop
Literature search

2 open access papers mention tae-MIR1123
(2 sentences)

Stem-loop
            a                  -auaaau             c       a          g                        a    -      -    a 
5' aaaaaaauu uaugagaccaggucucau       caggugagacccg ccugaug augacaugug cauucacaaaucacaaagcaucua ucuc uccccc ccug u
   ||||||||| ||||||||||||||||||       ||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||| |||| |||||| ||||  
3' uuuuuuuaa auacucugguccagagug       guccacucugggu ggacuac uacugugcac guaaguguuuaguguuucguaggu gggg gggggg ggac u
            g                  ccuaauc             a       c          a                        -    u      u    u 
Get sequence
Deep sequencing
61631 reads, 4.31 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR507 in [1]. miR1123 is unrelated to mammalian miR-507;

Genome context
Coordinates Overlapping transcripts
5B: 186584681-186584898 [-]
intergenic
Database links

Mature sequence tae-miR1123

Accession MIMAT0005358
Sequence

188 - 

uccgugagaccuggucucauaga

 - 210

Get sequence
Deep sequencing1427 reads, 116 experiments
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).