Stem-loop sequence mml-mir-1225

AccessionMI0006312 (change log)
DescriptionMacaca mulatta miR-1225 stem-loop
Gene family MIPF0000445; mir-1225
   guggguacggcccag      -  - g    acacgcccugggcucugccca 
5'                uggggg gg a aggg                     g
                  |||||| || | ||||                      
3'                accccc cc u uccc                     g
   --------------g      g  g g    cgagucagucaggccgacgug 
Get sequence
Deep sequencing
117 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 2107946-2108035 [-]
Database links

Mature sequence mml-miR-1225-5p

Accession MIMAT0005574

1 - 


 - 21

Get sequence
Deep sequencing90 reads, 4 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence mml-miR-1225-3p

Accession MIMAT0005575

68 - 


 - 90

Get sequence
Deep sequencing18 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets


PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).