Stem-loop sequence mml-mir-1227

AccessionMI0006317 (change log)
DescriptionMacaca mulatta miR-1227 stem-loop
Gene family MIPF0000454; mir-1227
   guggggccaggcgguggugggcaccgcu    ug     ------   a   a     
5'                             gggg  ggcac      agc gcc ugca 
                               ||||  |||||      ||| ||| ||| g
3'                             cucc  ccgug      ucg cgg acga 
   --------------------gaccccuu    ua     ccccag   a   -     
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 2118507-2118594 [-]
ENSMMUT00000025220 ; C19orf35-201; intron 1
Database links

Mature sequence mml-miR-1227

Accession MIMAT0005581

1 - 


 - 20

Get sequence
Evidence experimental; cloned [1]
Predicted targets


PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).