miRBase entry: hsa-mir-663b

Stem-loop hsa-mir-663b


Accession
MI0006336
Symbol
HGNC: MIR663B
Description
Homo sapiens hsa-mir-663b precursor miRNA mir-663
Gene
family?
RF00957; mir-663

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR663B is a microRNA gene located on chromosome 2, specifically upstream of 2q21.2, and is implicated in various cellular processes in cancer biology [PMC3016268]. It is situated within the intron of the ANKDR30BL gene and has been observed to be down-regulated in patients with certain immune characteristics [PMC7439310]. This down-regulation of MIR663B has been associated with increased expression of genes that can lead to enhanced cell proliferation, migration, and invasion while inhibiting apoptosis [PMC7439310]. MIR663B also plays a role in the regulation of genes such as CCL17, CD40, and PIK3CD in chronic lymphocytic leukemia [PMC7439310]. Furthermore, high expression levels of MIR663B have been correlated with more aggressive cancer features such as distant metastasis and advanced tumor grading in endometrial cancer (EC) patients [PMC5796233]. In EC specifically, suppression of MIR663B has been shown to have oncogenic effects by upregulating Bcl-2 and reducing apoptosis within EC cells [PMC5796233]. Despite these findings, some studies have reported no significant changes in the expression levels of miRNAs including MIR663B over time although there was a trend observed for increased expression [PMC6416171].

Literature search
66 open access papers mention hsa-mir-663b
(264 sentences)

Sequence

137 reads, 74 reads per million, 45 experiments
ggugccgagggccguccggcauccuaggcgggucgcugcgguaccucccuccugucuguggcggugggaucccguggccguguuuuccuGGUGGCCCGGCCGUGCCUGAGGuuuc
...(((..((((((.((((..(((((((((.(..(((((((....((((.((.(((...))))).))))..)))))))).))....))))).)).)))).)).))))..)))...

Structure
ggu   ga    -  u    ca  -     ----  g uc       uacc    u  u   u 
   gcc  gggc cg ccgg  uc cuagg    cg g  gcugcgg    uccc cc guc  
   |||  |||| || ||||  || |||||    || |  |||||||    |||| || ||| g
   uGG  UCCG GC GGCC  GG GGucc    gu c  cggugcc    aggg gg cgg  
cuu   AG    U  C    -C  U     uuuu  g --       --cu    u  -   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 132256966-132257080 [-]

Disease association
hsa-mir-663b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-663b

Accession MIMAT0005867
Description Homo sapiens hsa-miR-663b mature miRNA
Sequence 90 - GGUGGCCCGGCCGUGCCUGAGG - 111
Evidence experimental
miRAP [1]
Database links
Predicted targets

References

  1. PubMed ID: 17989710
    MicroRNA expression profiles of human leukemias
    "Takada S, Yamashita Y, Berezikov E, Hatanaka H, Fujiwara SI, Kurashina K, Watanabe H, Enomoto M, Soda M, Choi YL, Mano H"
    "Leukemia (2008) 22:1274-1278