miRBase entry: vvi-MIR395h

Stem-loop vvi-MIR395h


Accession
MI0006563
Description
Vitis vinifera vvi-MIR395h precursor miRNA
Gene family
MIPF0000016; MIR395

Literature search
6 open access papers mention vvi-MIR395h
(23 sentences)

Sequence

7106 reads, 479 reads per million, 2 experiments
guccccuagaguucccuugaccacuucacuggggaccuucucuaauuauaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugcuau
....((..((((((((((((.(((((((.((((((...((............)).)))))).))))))).))))))))))))..))......

Structure
--gucc  ua            c       c      ccu  ucuaa 
      cc  gaguucccuuga cacuuca ugggga   uc     u
      ||  |||||||||||| ||||||| ||||||   ||      
      gg  CUCAAGGGGGUU GUGAAGU auccuu   ag     u
uaucgu  uc            U       C      --c  uaaua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6566652-6566743 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from vvi-MIR395h
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395h

Accession MIMAT0005718
Description Vitis vinifera vvi-miR395h mature miRNA
Sequence 62 - CUGAAGUGUUUGGGGGAACUC - 82
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558