Stem-loop sequence oan-mir-1349

AccessionMI0006743 (change log)
DescriptionOrnithorhynchus anatinus miR-1349 stem-loop
Stem-loop
       gg          a  aagcgcu        a  a  c   acu    u 
5' ggca  guguacugac gg       gggcugag ga gc gga   gugg g
   ||||  |||||||||| ||       |||||||| || || |||   ||||  
3' ucgu  uacgugacug cc       cccgacuc cu cg ccu   cacu c
       --          a  -------        a  c  a   ---    u 
Get sequence
Deep sequencing
380 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig19080: 2589-2682 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1349
oan-mir-200bContig19080: 7770-7878 [-]
oan-mir-200aContig19080: 5482-5595 [-]
oan-mir-1349Contig19080: 2589-2682 [-]
Database links

Mature sequence oan-miR-1349

Accession MIMAT0006934
Sequence

24 - 

gcugggcugagagaagccgga

 - 44

Get sequence
Deep sequencing379 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).