Stem-loop sequence oan-mir-200b

AccessionMI0006745 (change log)
DescriptionOrnithorhynchus anatinus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -----ucuggauuca       ca   c    -    ug     c      ugagu 
5'                gggccgc  cua cauc uuac  ggcag auugga     u
                  |||||||  ||| |||| ||||  ||||| ||||||     c
3'                cccggcg  ggu guag aaug  ccguc uaaucu     u
   agacaacaacgcaua       cc   a    u    gu     a      uugug 
Get sequence
Deep sequencing
30203 reads, 520 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig19080: 7770-7878 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-200b
oan-mir-200bContig19080: 7770-7878 [-]
oan-mir-200aContig19080: 5482-5595 [-]
oan-mir-1349Contig19080: 2589-2682 [-]
Database links

Mature sequence oan-miR-200b-5p

Accession MIMAT0006937
Previous IDsoan-miR-200b*
Sequence

24 - 

caucuuacugggcagcauugg

 - 44

Get sequence
Deep sequencing2938 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-200b-3p

Accession MIMAT0006938
Previous IDsoan-miR-200b
Sequence

61 - 

uaauacugccugguaaugaugau

 - 83

Get sequence
Deep sequencing27264 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).