Stem-loop sequence oan-mir-194-1

AccessionMI0006782 (change log)
DescriptionOrnithorhynchus anatinus miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   -gagaccaa    -gu     uau        aa      g    uuau 
5'          cagu   uauca   guaacagc  cuccau ugga    g
            ||||   |||||   ||||||||  |||||| ||||    c
3'          guca   guagu   cauugucg  gaggug accu    u
   caucaaacg    aag     uuu        ga      -    uuag 
Get sequence
Deep sequencing
32111 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig27098: 3308-3405 [+]
antisense
ENSOANT00000002259 ; IARS2-201; intron 11
Ultra67: 6368481-6368578 [-]
antisense
ENSOANT00000002259 ; IARS2-201; intron 11
Clustered miRNAs
< 10kb from oan-mir-194-1
oan-mir-194-1Contig27098: 3308-3405 [+]
oan-mir-215Contig27098: 4335-4452 [+]
Database links

Mature sequence oan-miR-194-5p

Accession MIMAT0006999
Previous IDsoan-miR-194
Sequence

22 - 

uguaacagcaacuccaugugga

 - 43

Get sequence
Deep sequencing64305 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).