Stem-loop sequence gma-MIR1514a

Accession

MI0007226 (change log)

Description

Glycine max miR1514a stem-loop

Gene family

MIPF0000694; MIR1514

Literature search

5 open access papers mention gma-MIR1514a
(12 sentences)

Stem-loop

   cuuugcua          u                 cccuucuuguucc 
5'         uuuucauuuu aaaauaggcauuggggu             u
           |||||||||| |||||||||||||||||              
3'         aaaaguaaaa uuuuauccguaacccua             c
   auagcaac          -                 uccuuuccuuuuc 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr7: 43120760-43120858 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0007226

Mature sequence gma-miR1514a-5p

• Accession: MIMAT0007372
• Previous IDs: gma-miR1514a
• Sequence: 11 - uucauuuuuaaaauaggcauu - 31
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence gma-miR1514a-3p

• Accession: MIMAT0032031
• Sequence: 71 - augccuauuuuaaaaugaaaa - 91
• Evidence: experimental; Illumina [2]

References

1. PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).