![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1514a |
|||||
Accession | MI0007226 (change log) | ||||
Description | Glycine max miR1514a stem-loop | ||||
Gene family | MIPF0000694; MIR1514 | ||||
Literature search |
![]()
5 open access papers mention gma-MIR1514a | ||||
Stem-loop |
cuuugcua u cccuucuuguucc 5' uuuucauuuu aaaauaggcauuggggu u |||||||||| ||||||||||||||||| 3' aaaaguaaaa uuuuauccguaacccua c auagcaac - uccuuuccuuuuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1514a-5p |
|
Accession | MIMAT0007372 |
Previous IDs | gma-miR1514a |
Sequence |
11 - uucauuuuuaaaauaggcauu - 31 |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence gma-miR1514a-3p |
|
Accession | MIMAT0032031 |
Sequence |
71 - augccuauuuuaaaaugaaaa - 91 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|