Stem-loop sequence gga-mir-1579

AccessionMI0007305 (change log)
DescriptionGallus gallus miR-1579 stem-loop
Stem-loop
      g    -   -aag      g  c   -c      
5' gcc uggc ggg    ggaugg cg gug  gcggg 
   ||| |||| |||    |||||| || |||  |||| c
3' cgg accg ccc    ucugcc gc cac  cgccu 
      -    a   gccg      -  -   uc      
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 2663996-2664062 [+]
intergenic
Database links

Mature sequence gga-miR-1579

Accession MIMAT0007440
Sequence

3 - 

cguggcgggaagggaugggcg

 - 23

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).