Stem-loop sequence gga-mir-1583

AccessionMI0007309 (change log)
DescriptionGallus gallus miR-1583 stem-loop
Stem-loop
   u      -    agg      g   --c  u               -   g 
5'  cgcugg gcgg   gcgcgg ucg   cu ccgucccgcggcucu cgg c
    |||||| ||||   |||||| |||   || ||||||||||||||| |||  
3'  gcggcc ugcc   cgugcc agc   ga ggcagggugccggga gcc g
   g      g    --g      g   cuc  c               u   g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 70734341-70734438 [+]
sense
ENSGALT00000044607 ; XPA-201; intron 4
Clustered miRNAs
< 10kb from gga-mir-1583
gga-mir-2954chrZ: 70733043-70733110 [+]
gga-mir-1583chrZ: 70734341-70734438 [+]
gga-mir-2131chrZ: 70743817-70743905 [-]
Database links

Mature sequence gga-miR-1583

Accession MIMAT0007444
Sequence

52 - 

cguagggccgugggacggca

 - 71

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).