Stem-loop sequence gga-mir-1633

AccessionMI0007363 (change log)
DescriptionGallus gallus miR-1633 stem-loop
Literature search

1 open access papers mention gga-mir-1633
(1 sentences)

Stem-loop
   u  gu   g    g -  u ug      ---u      cu  g     g 
5'  gg  uug agcu a gc c  cgcuuc    gcucag  cg ugucu a
    ||  ||| |||| | || |  ||||||    ||||||  || |||||  
3'  cc  aac ucgg u cg g  gcgaag    cgaguc  gu acgga g
   a  uc   g    g a  - gu      ucgu      cg  a     g 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 5334540-5334634 [-]
intergenic
Database links

Mature sequence gga-miR-1633

Accession MIMAT0007506
Sequence

20 - 

ugcgcuucugcucagcucggugu

 - 42

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).