Stem-loop sequence gga-mir-1650

AccessionMI0007382 (change log)
DescriptionGallus gallus miR-1650 stem-loop
Literature search

1 open access papers mention gga-mir-1650
(3 sentences)

Stem-loop
   ----- ga  cu   c   u   -       ag  -   -    -c   ca 
5'      g  ag  cug cag ggc aagcuga  gc cag ggag  agc  c
        |  ||  ||| ||| ||| |||||||  || ||| ||||  |||  a
3'      c  uc  gac guc ccg uucgacu  cg guc ccuc  ucg  g
   ccugu uc  -u   c   u   c       --  a   u    aa   ac 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 22742586-22742678 [-]
intergenic
Database links

Mature sequence gga-miR-1650

Accession MIMAT0007528
Sequence

54 - 

uccucugagcucagcuucgccucu

 - 77

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).