Stem-loop sequence gga-mir-1674

AccessionMI0007408 (change log)
DescriptionGallus gallus miR-1674 stem-loop
Literature search

2 open access papers mention gga-mir-1674
(5 sentences)

Stem-loop 
   ggua  ag  uu     -  g    uga       uuu   g    aag 
5'     ag  ca  ccugc ag gcua   ugcugga   ucu agca   g
       ||  ||  ||||| || ||||   |||||||   ||| ||||   g
3'     uc  gu  ggacg uc uggu   guggcuu   agg uugu   a
   ----  gg  uc     g  g    ugg       ugu   g    cgu
Get sequence
Deep sequencing
36 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 22802920-22803015 [+]
sense
ENSGALT00000012572 ; POLL-201; intron 4
Database links

Mature sequence gga-miR-1674

Accession MIMAT0007558
Sequence

19 -  

gggcuaugaugcuggauuuucugag

 - 43

Get sequence
Deep sequencing30 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).