Stem-loop sequence gga-mir-1704

AccessionMI0007439 (change log)
DescriptionGallus gallus miR-1704 stem-loop
Literature search

1 open access papers mention gga-mir-1704
(1 sentences)

Stem-loop
      -c   a    a      auu  ug       cca 
5' gac  gag auuc cagcag   ga  gggcaca   a
   |||  ||| |||| ||||||   ||  |||||||    
3' cug  cuc uagg gucguc   cu  uccgugu   g
      cc   g    -      ---  ug       cua 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 4883788-4883858 [+]
sense
ENSGALT00000009725 ; SNED1-201; intron 1
Database links

Mature sequence gga-miR-1704

Accession MIMAT0007596
Sequence

13 - 

acagcagauugauggggcaca

 - 33

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).