Stem-loop sequence gga-mir-1714

AccessionMI0007451 (change log)
DescriptionGallus gallus miR-1714 stem-loop
Stem-loop
   u   g   gcc        cu    -       cua  gc 
5'  gcu cuu   uaguaggg  gcug aggugau   gg  a
    ||| |||   ||||||||  |||| |||||||   ||   
3'  cga gaa   gucauccu  uggu uccacug   uc  u
   a   a   --a        cc    a       ---  ac 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 114704973-114705048 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1714
gga-mir-124cchr2: 114701957-114702057 [-]
gga-mir-124achr2: 114701964-114702059 [+]
gga-mir-1714chr2: 114704973-114705048 [+]
Database links

Mature sequence gga-miR-1714

Accession MIMAT0007610
Sequence

10 - 

ccuaguagggcugcugaggugau

 - 32

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).