Stem-loop sequence gga-mir-1777

AccessionMI0007520 (change log)
DescriptionGallus gallus miR-1777 stem-loop
Literature search

1 open access papers mention gga-mir-1777
(1 sentences)

Stem-loop
   gcuucaccu    -    a   g            -    g   cag   c 
5'          uccc cucc gcu ugggcggugcgg ggcg cgu   ggc c
            |||| |||| ||| |||||||||||| |||| |||   ||| a
3'          gggg gagg ugg gcccgcuacgcc cugc gcg   ccg c
   --------c    u    g   g            a    g   aca   u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 3243053-3243147 [+]
antisense
ENSGALT00000024511 ; GZMM-201; exon 3
AADN04011948.1: 5931-6025 [-]
antisense
ENSGALT00000024511 ; GZMM-201; exon 3
Database links

Mature sequence gga-miR-1777

Accession MIMAT0007688
Sequence

22 - 

gugggcggugcggggcggcg

 - 41

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).