Stem-loop sequence gga-mir-1790

AccessionMI0007533 (change log)
DescriptionGallus gallus miR-1790 stem-loop
Literature search

1 open access papers mention gga-mir-1790
(1 sentences)

Stem-loop
          ---   gaug     gggg  ggg    g      g   u   g g  gg 
5' ggcgggg   cgg    ccgcu    cc   ccuc ugccgu cuc gcu g cc  a
   |||||||   |||    |||||    ||   |||| |||||| ||| ||| | ||   
3' ucgcuuc   guc    ggcga    gg   gggg guggcg gag ugg c gg  g
          uuu   --ga     ---a  gaa    -      g   -   g -  aa 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 11628647-11628751 [-]
intergenic
Database links

Mature sequence gga-miR-1790

Accession MIMAT0007703
Sequence

61 - 

cgggugagggcgguggggga

 - 80

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).