Stem-loop mml-mir-33b

Accession

MI0007603

Description

Macaca mulatta mml-mir-33b precursor miRNA

Gene family

MIPF0000070; mir-33

Sequence

1221 reads, 9 reads per million, 9 experiments

gcgggcggccccgcgGUGCAUUGCUGUUGCAUUGCacgugugugaggcgggugcaGUGCCUCGGCAGUGCAGCCCggagccggccccuggcaccgc
((((.((((.(((.((((((((((((..(((((((((.(((.....))).)))))))))..)))))))))).))))).))))(((...))).))))

Structure

    ---------g    c   c  -          UU         g   g 
gcgg          cggc ccg gG UGCAUUGCUG  GCAUUGCac ugu u
||||          |||| ||| || ||||||||||  ||||||||| ||| g
cgcc          gccg ggC CC ACGUGACGGC  CGUGacgug gcg a
    acgguccccg    a   -  G          UC         g   g 

Annotation confidence High

Genome context

chr16: 17953778-17953873 [-]

Mature mml-miR-33b-5p

• Accession: MIMAT0006173
• Description: Macaca mulatta mml-miR-33b-5p mature miRNA
• Sequence: 16 - GUGCAUUGCUGUUGCAUUGC - 35
• Evidence: experimental ; Illumina [2]

Mature mml-miR-33b-3p

• Accession: MIMAT0026808
• Description: Macaca mulatta mml-miR-33b-3p mature miRNA
• Sequence: 56 - GUGCCUCGGCAGUGCAGCCC - 75
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 18186931
   Identification of novel homologous microRNA genes in the rhesus macaque genome
   Yue J, Sheng Y, Orwig KE
   BMC Genomics (2008) 9:8


2. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45