Stem-loop sequence gga-mir-216b

AccessionMI0008205 (change log)
DescriptionGallus gallus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   gaguca    c  -    a          c  a     ---  u  u 
5'       caga ug ggaa ucucugcagg aa uguga   ug cu u
         |||| || |||| |||||||||| || |||||   || ||  
3'       gucu ac ucuu agagaugucc uu acacu   ac ga a
   -cuacg    a  a    -          a  a     cua  -  u 
Get sequence
Deep sequencing
467 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 323483-323571 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-216b
gga-mir-216cchr3: 323485-323570 [+]
gga-mir-216bchr3: 323483-323571 [-]
gga-mir-216achr3: 318076-318181 [-]
gga-mir-217chr3: 315408-315514 [-]
Database links

Mature sequence gga-miR-216b

Accession MIMAT0007748
Sequence

16 - 

aaaucucugcaggcaaauguga

 - 37

Get sequence
Deep sequencing461 reads, 5 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).