Stem-loop sequence gga-mir-762

AccessionMI0008209 (change log)
DescriptionGallus gallus miR-762 stem-loop
Gene family MIPF0000624; mir-762
Literature search

1 open access papers mention gga-mir-762
(1 sentences)

Stem-loop
       g     ggg    gg   gca    cc     g cau 
5' gccc gcucc   ucuc  ccc   ccga  ggccc a   g
   |||| |||||   ||||  |||   ||||  ||||| |    
3' cggg cgggg   gggg  ggg   gguu  ucggg u   c
       a     --a    -a   agg    --     g cgu 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 5751890-5751968 [-]
antisense
ENSGALT00000006984 ; gga-mir-762-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-762

Accession MIMAT0007752
Sequence

48 - 

ggggcuuuggggagggagggga

 - 69

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).