miRBase entry: ssc-mir-15a

Stem-loop ssc-mir-15a


Accession
MI0008211
Description
Sus scrofa ssc-mir-15a precursor miRNA
Gene family
MIPF0000006; mir-15

Literature search
20 open access papers mention ssc-mir-15a
(93 sentences)

Sequence

97 reads, 102 reads per million, 11 experiments
uuggaguaaagUAGCAGCACAUAAUGGUUUGUggauuuugaaaaggugcaggccauauugugcugccucaaaaauacaa
..........(..((((((((..((((((((((.............))))))))))..))))))))..)..........

Structure
uuggaguaaa UA        UA          gauuu 
          g  GCAGCACA  AUGGUUUGUg     u
          |  ||||||||  ||||||||||     g
          c  cgucgugu  uaccggacgu     a
aacauaaaaa uc        ua          ggaaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chrUScaf2048: 70414-70492 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ssc-mir-15a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-15a

Accession MIMAT0007753
Description Sus scrofa ssc-miR-15a mature miRNA
Sequence 12 - UAGCAGCACAUAAUGGUUUGU - 32
Evidence experimental
cloned [1,3], Illumina [2,4-5]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 18548309
    Identification and characterization of new microRNAs from pig
    "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
    "Mamm Genome (2008) 19:570-580

  4. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  5. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100