Stem-loop sequence mmu-mir-1899

AccessionMI0008318 (change log)
Symbol MGI:Mir1899
DescriptionMus musculus miR-1899 stem-loop
Literature search

3 open access papers mention mmu-mir-1899
(3 sentences)

Stem-loop
   --aaucu         --   -  c       -cu   u c    uagaa 
5'        uagucagcg  aug gc gaaucug   ucc c uggu     u
          |||||||||  ||| || |||||||   ||| | ||||      
3'        auuaguugc  uac cg cuuagac   agg g aucg     g
   aauacac         cu   u  u       uuu   u a    uguaa 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 8246786-8246881 [+]
intergenic
Database links

Mature sequence mmu-miR-1899

Accession MIMAT0007869
Sequence

11 - 

agcgauggccgaaucugcuucc

 - 32

Get sequence
Deep sequencing22 reads, 5 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).