![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-87 |
|||||
Accession | MI0008344 (change log) | ||||
Description | Bombyx mori miR-87 stem-loop | ||||
Gene family | MIPF0000152; mir-87 | ||||
Literature search |
2 open access papers mention bmo-mir-87 | ||||
Stem-loop |
---u aga u ua g ucg ag uauu 5' ga agu cgg cacuaaug gccugaa uugcuc accug u || ||| ||| |||||||| ||||||| |||||| ||||| 3' cu ucg gcc gugauugu uggacuu aacgag uggac u acau -gg - -- g uca -- cagc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-miR-87 |
|
Accession | MIMAT0007900 |
Sequence |
62 - ugagcaaacuuucaggugugu - 82 |
Deep sequencing | 223 reads, 3 experiments |
Evidence | experimental; RT-PCR [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
2 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|