Stem-loop sequence bmo-mir-87

AccessionMI0008344 (change log)
DescriptionBombyx mori miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

2 open access papers mention bmo-mir-87
(2 sentences)

Stem-loop 
   ---u  aga   u   ua        g       ucg      ag     uauu 
5'     ga   agu cgg  cacuaaug gccugaa   uugcuc  accug    u
       ||   ||| |||  |||||||| |||||||   ||||||  |||||     
3'     cu   ucg gcc  gugauugu uggacuu   aacgag  uggac    u
   acau  -gg   -   --        g       uca      --     cagc
Get sequence
Deep sequencing
225 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581697.1: 299073-299173 [+]
intergenic
Database links

Mature sequence bmo-miR-87

Accession MIMAT0007900
Sequence

62 -  

ugagcaaacuuucaggugugu

 - 82

Get sequence
Deep sequencing223 reads, 3 experiments
Evidence experimental; RT-PCR [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).