![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-184 |
|||||
Accession | MI0008346 (change log) | ||||
Description | Bombyx mori miR-184 stem-loop | ||||
Gene family | MIPF0000059; mir-184 | ||||
Literature search |
![]()
7 open access papers mention bmo-mir-184 | ||||
Stem-loop |
g a - a gc u - au 5' gugca ug cgugcccuuguca uucuuc g cc gu gu u ||||| || ||||||||||||| |||||| | || || || u 3' caugu gc gcacgggaauagu aagagg c gg ca ca a - c c - -a u u ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-miR-184-5p |
|
Accession | MIMAT0015276 |
Previous IDs | bmo-miR-184* |
Sequence |
15 - ccuugucauucuucaggcccug - 36 |
Deep sequencing | 2 reads, 2 experiments |
Evidence | experimental; Illumina [3] |
Mature sequence bmo-miR-184-3p |
|
Accession | MIMAT0007902 |
Previous IDs | bmo-miR-184 |
Sequence |
50 - acuggacggagaacugauaagggc - 73 |
Deep sequencing | 1936 reads, 3 experiments |
Evidence | experimental; RT-PCR [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
2 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|