Stem-loop sequence bmo-mir-184

AccessionMI0008346 (change log)
DescriptionBombyx mori miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

7 open access papers mention bmo-mir-184
(15 sentences)

Stem-loop 
        g  a             -      a gc  u  -  au 
5' gugca ug cgugcccuuguca uucuuc g  cc gu gu  u
   ||||| || ||||||||||||| |||||| |  || || ||  u
3' caugu gc gcacgggaauagu aagagg c  gg ca ca  a
        -  c             c      - -a  u  u  ac
Get sequence
Deep sequencing
1938 reads, 267 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582034.1: 4769236-4769319 [-]
intergenic
Database links

Mature sequence bmo-miR-184-5p

Accession MIMAT0015276
Previous IDsbmo-miR-184*
Sequence

15 -  

ccuugucauucuucaggcccug

 - 36

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence bmo-miR-184-3p

Accession MIMAT0007902
Previous IDsbmo-miR-184
Sequence

50 -  

acuggacggagaacugauaagggc

 - 73

Get sequence
Deep sequencing1936 reads, 3 experiments
Evidence experimental; RT-PCR [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).