Stem-loop sequence ptr-mir-1302-1

AccessionMI0008516 (change log)
DescriptionPan troglodytes miR-1302-1 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-1
(2 sentences)

Stem-loop
   -   aaag  c     a            ag   a   u        gug  -      a  a     uac 
5'  cag    cc aguua auuugaauuuca  uaa caa gaauaauu   ua uguaag au uccca   a
    |||    || ||||| ||||||||||||  ||| ||| ||||||||   || |||||| || |||||   a
3'  guc    gg ucaau uaaacuuaaagu  auu guu cuuauuaa   au guauuc ua agggu   u
   u   cuua  a     g            cu   c   c        -aa  c      a  c     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 115824278-115824419 [-]
sense
ENSPTRT00000068726 ; ptr-mir-1302-1-201; exon 1
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

75 - 

uugggacauacuuaugcuaaa

 - 95

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).