Stem-loop sequence ptr-mir-1302-3

AccessionMI0008518 (change log)
DescriptionPan troglodytes miR-1302-3 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-3
(2 sentences)

Stem-loop
   ---     ccag       -                  g      --uucg        a              
5'    gaugc    uuaguuu gaauuuuagauaaacaac aauaau      uagcauaa uaugucccaagcu 
      |||||    ||||||| |||||||||||||||||| ||||||      |||||||| |||||||||||| u
3'    uuacg    aauuaaa cuuagagucuauuuguug uuauua      aucguauu auacaggguuuga 
   auu     ----       a                  g      caaaaa        c              
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
AACZ04009448.1: 150-286 [+]
intergenic
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

72 - 

uugggacauacuuaugcuaaa

 - 92

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).