Stem-loop sequence ptr-mir-1302-5

AccessionMI0008520 (change log)
DescriptionPan troglodytes miR-1302-5 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-5
(2 sentences)

Stem-loop
   -      ccag     -                    g      --  c         a              
5'  ggaugc    uuagu uugaauuuuagauaaacaac aauaau  uu uuagcauaa uaugucccaagcu 
    ||||||    ||||| |||||||||||||||||||| ||||||  || ||||||||| |||||||||||| u
3'  uuuacg    aauua gacuuagagucuauuuguug uuauua  aa aaucguauu auacaggguuuga 
   u      ----     a                    g      ca  a         c              
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
AACZ04049562.1: 692-828 [+]
intergenic
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

73 - 

uugggacauacuuaugcuaaa

 - 93

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).