Stem-loop sequence ptr-mir-1302-6

AccessionMI0008521 (change log)
DescriptionPan troglodytes miR-1302-6 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-6
(2 sentences)

Stem-loop
   -        a   gg  a    u     g    cac      uag 
5'  aacaaaua uuu  ua uaua guaug ccca   aauauu   g
    |||||||| |||  || |||| ||||| ||||   ||||||   a
3'  uuguuuau aaa  au guau cauac gggu   uuauaa   c
   g        g   aa  c    u     a    ---      caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 17197808-17197896 [-]
sense
ENSPTRT00000068676 ; ptr-mir-1302-6-201; exon 1
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

56 - 

uugggacauacuuaugcuaaa

 - 76

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).