Stem-loop sequence ptr-mir-1302-7

AccessionMI0008522 (change log)
DescriptionPan troglodytes miR-1302-7 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-7
(2 sentences)

Stem-loop
   ac     ----g         cau        g ugc 
5'   aacau     uuuuuagua   guaugucu g   a
     |||||     |||||||||   |||||||| |   a
3'   uugug     aaaaaucgu   cauacagg u   u
   --     auuaa         auu        g uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 144469370-144469440 [-]
intergenic
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

39 - 

uugggacauacuuaugcuaaa

 - 59

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).