![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-337 |
||||||||||||||
Accession | MI0008624 (change log) | |||||||||||||
Description | Pan troglodytes miR-337 stem-loop | |||||||||||||
Gene family | MIPF0000195; mir-337 | |||||||||||||
Stem-loop |
uagucagua uu - c u c - ca 5' g ggggggugg gaa ggc ucaua aggaguug aug c | ||||||||| ||| ||| ||||| |||||||| ||| 3' c uccccuacu cuu ccg aguau uccucgac uau a -------aa -u u u u a c ug |
|||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence ptr-miR-337 |
|
Accession | MIMAT0008105 |
Sequence |
60 - cuccuauaugaugccuuucuuc - 81 |
Evidence | by similarity; MI0000806 |
Predicted targets |
|
References |
|
1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|