Stem-loop sequence ptr-mir-433

AccessionMI0008668 (change log)
DescriptionPan troglodytes miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

1 open access papers mention ptr-mir-433
(89 sentences)

Stem-loop
   cgg      gua   u           u   --------  g     cu 
5'    ggagaa   cgg gagccugucau auu        ca agagg  a
      ||||||   ||| ||||||||||| |||        || |||||   
3'    ccucuu   gcu cucggguagua uag        gu ucucc  g
   gga      gug   c           c   gaagaguu  g     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86126847-86126938 [+]
sense
ENSPTRT00000054782 ; ptr-mir-433-201; exon 1
antisense
ENSPTRT00000012391 ; ptr-mir-136-201; exon 2
Clustered miRNAs
< 10kb from ptr-mir-433
ptr-mir-337chr14: 86119486-86119577 [+]
ptr-mir-665chr14: 86120026-86120096 [+]
ptr-mir-431chr14: 86125968-86126080 [+]
ptr-mir-433chr14: 86126847-86126938 [+]
ptr-mir-127chr14: 86127939-86128035 [+]
ptr-mir-432chr14: 86129447-86129539 [+]
ptr-mir-136chr14: 86129665-86129746 [+]
Database links

Mature sequence ptr-miR-433

Accession MIMAT0008147
Sequence

63 - 

aucaugaugggcuccucggugu

 - 84

Get sequence
Evidence by similarity; MI0001723
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).