Stem-loop sequence ptr-mir-665

AccessionMI0008849 (change log)
DescriptionPan troglodytes miR-665 stem-loop
Gene family MIPF0000404; mir-665
Stem-loop
   -- u    -          c      -acc  g  c 
5'   c ccug gaggggucuc gccucu    ca ga u
     | |||| |||||||||| ||||||    || || c
3'   g ggac cuccccggag cggagg    gu cu u
   cg c    a          u      acca  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86120026-86120096 [+]
sense
ENSPTRT00000060883 ; ptr-mir-665-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-665
ptr-mir-337chr14: 86119486-86119577 [+]
ptr-mir-665chr14: 86120026-86120096 [+]
ptr-mir-431chr14: 86125968-86126080 [+]
ptr-mir-433chr14: 86126847-86126938 [+]
ptr-mir-127chr14: 86127939-86128035 [+]
ptr-mir-432chr14: 86129447-86129539 [+]
ptr-mir-136chr14: 86129665-86129746 [+]
Database links

Mature sequence ptr-miR-665

Accession MIMAT0008312
Sequence

42 - 

accaggaggcugaggccccu

 - 61

Get sequence
Evidence by similarity; MI0005563
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).