Stem-loop sequence mmu-mir-1932

AccessionMI0009921 (change log)
Symbol MGI:Mir1932
DescriptionMus musculus miR-1932 stem-loop
Stem-loop
   --  -a  c   c  u  a       c  ga    c      cauu 
5'   gc  gg agc gg cc gccuggc cu  gucu cgaccc    a
     ||  || ||| || || ||||||| ||  |||| ||||||    a
3'   cg  cc ucg cc gg uggaucg ga  cagg guuggg    c
   aa  ac  c   u  c  c       c  --    c      cucu 
Get sequence
Deep sequencing
172 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 119390472-119390561 [+]
intergenic
Database links

Mature sequence mmu-miR-1932

Accession MIMAT0009395
Sequence

53 - 

guugcggacagcgcuaggucgg

 - 74

Get sequence
Deep sequencing167 reads, 50 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).