Stem-loop sequence mmu-mir-1941

AccessionMI0009930 (change log)
Symbol MGI:Mir1941
DescriptionMus musculus miR-1941 stem-loop
Stem-loop
   --   ca      ga           g  c   g    gggg 
5'   cag  gggugg  gggagaugcug ua aga gcuu    u
     |||  ||||||  ||||||||||| || ||| ||||     
3'   guc  cccacc  cccucuaugac au ucu cggg    u
   gg   ca      ua           g  -   a    aguu 
Get sequence
Deep sequencing
605 reads, 0 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 101369352-101369434 [+]
antisense
ENSMUST00000077196 ; Krt80-201; intron 1
Database links

Mature sequence mmu-miR-1941-5p

Accession MIMAT0009405
Sequence

13 - 

agggagaugcugguacagaggcuu

 - 36

Get sequence
Deep sequencing492 reads, 58 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1941-3p

Accession MIMAT0009406
Sequence

50 - 

caucuuagcaguaucucccau

 - 70

Get sequence
Deep sequencing103 reads, 37 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).