Stem-loop sequence mmu-mir-1946a

AccessionMI0009936 (change log)
Symbol MGI:Mir1946a
DescriptionMus musculus miR-1946a stem-loop
Literature search

1 open access papers mention mmu-mir-1946a
(1 sentences)

Stem-loop
   --   -uu    --aaaucuau       c         a  ca     a   ---ccaa       gag 
5'   aac   aaag          agccggg agugguggc ca  cuuuu auc       cacuugu   g
     |||   ||||          ||||||| ||||||||| ||  ||||| |||       |||||||   c
3'   uug   uuuc          ucggcuc ucaccaccg gu  ggaaa uag       guggacg   a
   aa   uuu    cucuccucuu       -         c  ac     c   ucuuuag       gac 
Get sequence
Deep sequencing
7976 reads, 49 reads per million, 102 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 32267450-32267583 [-]
intergenic
Database links

Mature sequence mmu-miR-1946a

Accession MIMAT0009412
Sequence

18 - 

agccgggcagugguggcacacacuuuu

 - 44

Get sequence
Deep sequencing5356 reads, 80 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).