Stem-loop sequence mmu-mir-1956

AccessionMI0009952 (change log)
Symbol MGI:Mir1956
DescriptionMus musculus miR-1956 stem-loop
Gene family MIPF0001470; mir-1956
Stem-loop
   --  uca       -   g      c      cc 
5'   cu   guccagg gcu agucag ggagcc  g
     ||   ||||||| ||| |||||| ||||||   
3'   ga   caggucc cgg ucgguc cuucgg  a
   cg  -ug       a   -      c      ug 
Get sequence
Deep sequencing
586 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 138526421-138526485 [+]
sense
ENSMUST00000029803 ; Eif4e-201; intron 1
ENSMUST00000157748 ; Mir1956-201; exon 1
Database links

Mature sequence mmu-miR-1956

Accession MIMAT0009428
Sequence

5 - 

aguccagggcugagucagcgga

 - 26

Get sequence
Deep sequencing559 reads, 51 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).